euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence AF009606_9549_9646_C1a


Tools

>gnl|euhcvdb|AF009606_9549_9646_C1a 3UTR conserved X region
ggtggctccatcttagccctagtcacggctagctgtgaaaggtccgtgagccgcatgactgcagagagtgctgatactgg
cctctctgcagatcatgt


© 1998-2020 Legal notice