euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence AF009606_44_118_C1a


Tools

>gnl|euhcvdb|AF009606_44_118_C1a 5UTR domain II is a component of the IRES
cctgtgaggaactactgtcttcacgcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccagg


© 1998-2020 Legal notice