euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence D10750_1_20_C1b


Tools

>gnl|euhcvdb|D10750_1_20_C1b 5UTR domain I has a regulatory effect for the replication and translation of the genome
gccagcccccgattgggggc


© 1998-2020 Legal notice