euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence AF054249_1_342_C1b


Tools

>gnl|euhcvdb|AF054249_1_342_C1b 5UTR highly conserved genomic region (contains four structural domains (I to IV), domains II to IV make up the internal ribosome entry site (IRES))
gccagccccctgatgggggcgacactccaccatgaatcactcccctgtgaggaactactgtcttcacgcagaaagcgtct
agccatggcgttagtatgagtgtcgtgcagcctccaggaccccccctcccgggagagccatagtggtctgcggaaccggt
gagtacaccggaattgccaggacgaccgggtcctttcttggatcaaacccgctcaatgcctggagatttgggcgtgcccc
cgcgagactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatagggtgcttgcgagtgccccgg
gaggtctcgtagaccgtgcacc


© 1998-2020 Legal notice