euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence AF054247_E1_C1b


Tools

>gnl|euhcvdb|AF054247_E1_C1b E1 protein coding sequence (e1 sequence)
tatgaagtgcgcaacgtgtccgggatataccatgtcacgaacgactgctccaactcaagcattgtgtatgaggcagcgga
cgtgatcatgcatactcccgggtgcgtgccctgtgttcaggagggtaacagctcccgttgctgggtagcgctcactccca
cgctcgcggccaggaatgccagcgtccccactacgacaatacgacgccacgtcgacttgctcgttgggacggctgctttc
tgctccgctatgtacgtgggggatctctgcggatctattttcctcgtctcccagctgttcaccttctcgcctcgccggca
tgagacagtgcaggactgcaactgctcaatctatcccggccatgtatcaggtcaccgcatggcttgggatatgatgatga
actggtcacctacaacagccctagtggtgtcgcagttgctccggatcccacaagctgtcgtggacatggtggcgggggcc
cactggggagtcctggcgggccttgcctactattccatggtagggaactgggctaaggttctgattgtggcgctactctt
tgccggcgttgacggg


© 1998-2020 Legal notice