euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence L39309_1_447_P2n


Tools

>gnl|euhcvdb|L39309_1_447_P2n Feature gene - Hepatitis C virus partial genome, no 5'UTR, partial CDS (Contains: C, E1), no 3'UTR.
gacgggataaattatgcaacagggaaccttcctggttgctccttttctatcttcttgttggctcttctgtcttgtgtcac
cgtgcctgtctctgccgttgaggtcaaaaataccagtcrgrcctatatggcaaccaacgactgctccaacaacagcatcg
tatggcaattggaggacgcggtgcttcatgttcctggatgtgtcccctgcgagaatagctccggtcggttccactgttgg
atcccgatctcgcccaacatagccgtgagcaaacctggtgctctcaccaagggactgcgggcacacattgatgccgtcgt
gatgtccgccaccctctgctctgccctgtacgtgggagatgtgtgcggagcagtgatgatagctgcacaggctttcatcg
tggcaccgaagcgccattacttcgtccaggaatgcaattgctcaata


© 1998-2020 Legal notice