euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence D37863_1_1096_P6i


Tools

>gnl|euhcvdb|D37863_1_1096_P6i Feature CDS - Hepatitis C virus partial genome, no 5'UTR, partial CDS (Contains: NS5B), partial 3'UTR.
ggtcacggagcgcgacatacgtgccgagcaggacatatatctgtcttgccagctggacccagaagcccaacaggccatca
agtctcttaccgagaggctttacgttgggggccctatgtacaactcaaagggccagctctgcggccagcgcagatgccgg
gcgagcggagtgctgcccacgagcatgggcaacactataacatgctttctgaaagcgaaagccgcttgccgcgctgcagg
cttcaccaactttgacatgttggtctgcggagacgatttggtggtcatcgctgagagtgctggggtcaacgaggatatcg
ccaacctgcgagctttcacggaagccatgaccaggtattctgcgacccccggagatccacccagcccgtcgtacgaccta
gagctaataacatcatgctcttcaaacgtttccgtggcccatgatggagacggcagaaaatactactacctcacccgaga
cccagtcacacctcttgccagagcagcctgggagactgcccggcacactccagttaactcgtggctggggaacatcatca
tgtacgctcctgccatttgggtccgtatggtgctgatgacccattttttccaaatactccaagcacaggagacgttggac
aaggtacttgacttcgatatatacggagtcactcactcaatcactccacttgatctcccagtaatcatccaaagactcca
cggcatggccgcattctcactccatgggtactctcctggcgaactcaatcgcgtggcagcatgcctcagaaagcttgggg
ctccccctttgagagcctggagacaccgagcccgagcggtcagagcccagctgatcagccggggggggaaagccgcaata
tgcggcaagtacctcttcaattgggcggtaaaaaccaagctcaaactcactccattgcatggcgcgtccaacctggattt
gtcaggttggttcgcggcaggcttcagcgggggggacgtttatcacagcgcgtccagggctcgaccccgcatattactcc
tatgcctactcctactcacagtaggggtaggcatctttttgctcccagctcgatag


© 1998-2020 Legal notice