euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence AF054248_NS4A_C1b


Tools

>gnl|euhcvdb|AF054248_NS4A_C1b NS4A protein coding sequence (ns4a sequence)
agcacctgggtgccggtaggcggagtccttgcagctttggccgcatactgcctgacgacaggcagtgtggtcattgtggg
caggatcattttgtccgggaagccagctgtcgttcccgacagggaagtcctctaccaggagttcgatgagatggaagagt
gt


© 1998-2020 Legal notice