euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence AF054248_342_9374_C1b


Tools

>gnl|euhcvdb|AF054248_342_9374_C1b Feature CDS - Hepatitis C virus partial genome, complete 5'UTR, complete CDS (Contains: C, E1, E2, P7, NS2, NS3, NS4A, NS4B, NS5A, NS5B), partial 3'UTR.
atgagcacgaatcctaaacctcaaagaaaaaccaaacgtaacaccaaccgccgcccacaggacgtcaagttcccgggcgg
tggtcagatcgttggtggagtttacctgttgccgcgcaggggccccaggttgggtgtgcgtgcgactaggaaggcttccg
agcggtcgcaacctcgtggaaggcgacaacctatcccaaaggctcgccgacccgagggcagggcctgggctcagcccggg
tacccttggcccctctatggcaatgagggcctggggtgggcaggatggctcctgtcaccccgcggctcccggcctagttg
gggccccacggacccccggcgtaggtcgcgtaacttgggtaaggtcatcgatacccttacatgcggcttcgccgatctca
tggggtacattccgctcgtcggcgcccccctagggggcgctgccagggccttggcacacggtgtccgggttctggaggac
ggcgtgaactatgcaacagggaacttgcccggttgctctttctctatcttcctcttggctctgctgtcctgtttgaccat
cccagcttccgcttatgaagtgcgcaacgtgtccgggatataccatgtcacgaacgactgctccaactcaagcattgtgt
atgaggcagcggacgtgatcatgcatactcccgggtgcgtgccctgtgttcaggagggtaacagctcccgttgctgggta
gcgctcactcccacgctcgcggccaggaatgccagcgtccccactacgacaatacgacgccacgtcgacttgctcgttgg
gacggctgctttctgctccgctatgtacgtgggggatctctgcggatctattttcctcgtctcccagctgttcaccttct
cgcctcgccggcatgagacagtgcaggactacaactgctcaatctatcccggccatgtatcaggtcaccgcatggcttgg
gatatgatgatgaactggtcacctacaacagccctagtggtgtcgcagttgctccggatcccacaagctgtcgtggacat
ggtggcgggggcccactggggagtcctggcgggccttgcctactattccatggtagggaactgggctaaggttctgattg
tggcgctactctttgccggcgttgacggggagacccacacgacggggagggtggccggccacaccacctccgggttcacg
tcccttttctcatctggggcgtctcagaaaatccagcttgtgaataccaacggcagctggcacatcaacaggactgccct
aaattgcaatgactccctccaaactgggttctttgccgcgctgttttacgcacacaagttcaactcgtccgggtgcccgg
agcgcatggccagctgccgccccattgactggttcgcccaggggtggggccccatcacctatactaagcctaacagctcg
gatcagaggccttattgctggcattacgcgcctcgaccgtgtggtgtcgtacccgcgtcgcaggtgtgtggtccagtgta
ttgtttcaccccaagccctgttgtggtggggaccaccgatcgttccggtgtccctacgtatagctggggggagaatgaga
cagacatgatgctcctcaacaacacgcgtccgccacaaggcaactggttcggctgtacatggatgaatagtactgggttc
actaagacgtgcggaggtcccccgtgtaacatcgggggggtcggtaaccgcaccttgatctgccccacggactgcttccg
gaagcaccccgaggctacttacacaaaatgtggctcggggccctggttgacacctaggtgcctagtagactacccataca
ggctctggcactacccctgcactctcaatttttccatctttaaggttaggatgtatgtggggggcgtggagcacaggctc
aatgccgcatgcaattggactcgaggagagcgctgtaacttggaggacagggataggtcagaactcagcccgctgctgct
gtctacaacagagtggcagatactgccctgtgctttcaccaccctaccggctttatccactggtttgatccatctccatc
agaacatcgtggacgtgcaatacctgtacggtgtagggtcagcgtttgtctcctttgcaatcaaatgggagtacatcctg
ttgcttttccttctcctggcagacgcgcgcgtgtgtgcctgcttgtggatgatgctgctgatagcccaggctgaggccgc
cttagagaacttggtggtcctcaatgcggcgtccgtggccggagcgcatggtattctctcctttcttgtgttcttctgcg
ccgcctggtacattaagggcaggctggctcctggggcggcgtatgctttttatggcgtatggccgctgctcctgctccta
ctggcgttaccaccacgagcttacgccttggaccgggagatggctgcatcgtgcgggggtgcggttcttgtaggcctggt
attcttgaccttgtcaccatactacaaagtgtttctcactaggctcatatggtggttacaatactttatcaccagagccg
aggcgcacatgcaagtgtgggtcccccccctcaacgttcggggaggccgcgatgccatcatcctcctcacgtgtgcggtt
catccagagttaatttttgacatcaccaaactcctgctcgccatactcggcccgctcatggtgctccaggctggcataac
gagagtgccgtacttcgtgcgcgctcaagggctcattcgtgcatgcatgttagtgcgaaaagtcgccgggggtcattata
tccaaatggccttcatgaagctgggcgcgctgacaggtacgtacgtttataaccatcttaccccactgcgggactgggcc
cacgcgggcctacgagaccttgcggtggcggtagagcccgtcgtcttctccgccatggagaccaaggtcatcacctgggg
agcagacaccgctgcgtgtggggacatcatcttgggtctacccgtctccgcccgaagggggaaggagatatttctgggac
cggctgatagtctcgaagggcaagggtggcgactccttgcgcccatcacggcctactcccaacaaacgcggggcgtactt
ggttgcgtcatcactagcctcacaggccgggacaagaaccaggtcgaaggggaggttcaagtggtttctaccgcaacaca
atctttcctggcgacctgcatcaatggcgtgtgttggactgtctaccatggcgctggctcgaagaccctagccggtccaa
aaggtccaatcacccaaatgtacaccaatgtagacctggacctcgtcggctggcaggcgccccccggggcgcgctccatg
acaccatgcagctgtggcagctcggacctttacttggtcacgagacatgctgatgtcattccggtgcgccggcgaggcga
cagcaggggaagtctactctcccccaggcccgtctcctacctgaagggctcctcgggcggtccattgctttgcccttcgg
ggcacgtcgtgggcgtcttccgggctgctgtgtgcacccggggggtcgcgaaggcggtggacttcatacccgtcgagtct
atggaaactaccatgcggtccccggtcttcacagacaactcatcccccccggctgtaccgcagacatcccaagtggcaca
tctgcacgctcctactggcagcggcaagagcactaaagtgccggctgcgtatgcagcccaagggtacaaggtgctcgtcc
tgaacccgtccgttgccgccaccttagggtttggggcgtatatgtccaaggcacacggtatcgaccctaacatcagaact
ggggtaaggaccattaccacgggcggctccattacgtactccacctatggcaagttccttgccgacggtggctgctctgg
gggcgcctacgacatcataatatgtgatgagtgccactcaactgactcgactaccatcttgggcatcggcacagtcctgg
accaagcggagacggctggagcgcggcttgtcgtgctcgccaccgctacacctccgggatcggttaccgtgccacacccc
aatatcgaggaaataggcctgtccaacaatggagagatccccttctatggcaaagccatccccattgaggccatcaaggg
ggggaggcatctcattttctgccattccaagaagaaatgcgacgagctcgccgcaaagctgacaggcctcggactgaacg
ctgtagcatattaccggggccttgatgtgtccgtcataccgcctatcggagacgtcgttgtcgtggcaacagacgctcta
atgacgggtttcaccggcgattttgactcagtgatcgactgcaatacatgtgtcacccagacagtcgacttcagcttgga
tcccaccttcaccattgagacgacgaccgtgccccaagacgcggtgtcgcgctcgcaacggcgaggtagaactggcaggg
gtaggagtggcatctacaggtttgtgactccaggagaacggccctcgggcatgttcgattcttcggtcctgtgtgagtgc
tatgacgcgggctgtgcttggtatgagctcacgcccgctgagacctcggttaggttgcgggcttacctaaatacaccggg
gttgcccgtctgccaggaccatctggagttctgggagagcgtcttcacaggcctcacccacatagatgcccacttcctgt
cccagactaaacaggcaggagacaactttccttacctggtggcatatcaagctacagtgtgcgccagggctcaagctcca
cctccatcgtgggaccaaatgtggaagtgtctcatacggctgaaacctacactgcacgggccaacacccctgctgtatag
gctaggagccgtccaaaatgaggtcatcctcacacaccccataactaaatacatcatggcatgcatgtcggctgacctgg
aggtcgtcactagcacctgggtgccggtaggcggagtccttgcagctttggccgcatactgcctgacgacaggcagtgtg
gtcattgtgggcaggatcattttgtccgggaagccagctgtcgttcccgacagggaagtcctctaccaggagttcgatga
gatggaagagtgtgcctcacaacttccttacatcgagcagggaatgcagctcgccgagcaattcaagcaaaaggcgctcg
ggttgttgcaaacggccaccaagcaagcggaggctgctgctcccgtggtggagtccaggtggcgagcccttgagaccttc
tgggcgaagcacatgtggaatttcatcagcggaatacagtacctagcaggcttatccactctgcctggaaaccccgcgat
agcatcattgatggcatttacagcttctatcactagcccgctcaccacccaacacaccctcctgtttaacatcttggggg
gatgggtggctgcccagctcgctcctcccagcgctgcgtcagctttcgtgggcgccggcatcgccggagcggctgttggc
agcataggccttgggaaggtgctcgtggacatcttggcgggctatggggcaggggtagccggcgcactcgtggcctttaa
ggtcatgagtggcgaggtgccctccaccgaggacctggtcaacttactccctgccatcctctctcctggtgccctggtcg
tcggggtcgtgtgcgcagcaatactgcgtcggcacgtgggcccgggagagggagctgtgcagtggatgaaccggctgata
gcgttcgcttcgcggggtaaccacgtctcccccacgcactatgtgcctgagagcgacgctgcagcacgtgtcactcagat
cctctctagccttaccatcactcaactgctgaagcggcttcaccagtggattaatgaggactgctctacgccatgctccg
gctcgtggctaagggatgtttgggattggatatgcacggtgttgactgacttcaagacctggctccagtccaagctcctg
ccgcggttaccgggagtccctttcctgtcatgccaacgcgggtacaagggagtctggcggggggacggcatcatgcaaac
cacctgcccatgtggagcacagatcgccggacatgtcaaaaacggttccatgaggatcgtagggcctagaacctgcagca
acacgtggcacggaacgttccccatcaacgcatacaccacgggaccttgcacaccctccccggcgcccaactattccagg
gcgctatggcgggtggctgctgaggagtacgtggaggttacgcgtgtgggggatttccactacgtgacgggcatgaccac
tgacaacgtaaagtgcccatgccaggttccggcccccgaattcttcacggaggtggatggagtgcggttgcacaggtacg
ctccggcgtgcaaacctctcctacgggaggacgtcacgttccaggtcgggctcaaccaatacttggtcgggtcgcagctc
ccatgcgagcccgaaccggacgtaacggtgcttacttccatgctcaccgatccctcccacattacagcagagacggctaa
gcgtaggctggctagagggtcccccccctctttagccagctcatcagctagccagttgtctgcgccttctttgaaggcga
catgcactacccaccatgactccccggacgctgacctcatcgaggccaacctcttgtggcggcaggagatgggcggaaac
atcactcgcgtggagtcagagaataaggtagtaattctggactctttcgaaccgcttcacgcggagggggatgagaggga
gatatccgtcgcggcggagatcctgcgaaaatccaggaagttcccctcagcgttgcccatatgggcacgcccggactaca
atcctccactgctagagtcctggaaggacccggactacgtccctccggtggtacacggatgcccattgccacctaccaag
gctcctccaataccacctccacggagaaagaggacggttgtcctgacagaatccaatgtgtcttctgccttggcggagct
cgccactaagaccttcggtagctccggatcgtcggccgttgatagcggcacggcgaccgcccttcctgacctggcctccg
acgacggtgacaaagggtccgacgttgagtcgtactcctccatgcccccccttgaaggggagccgggggaccccgatctc
agcgacgggtcttggtctaccgtgagtgaggaggctagtgaggacgtcgtctgctgctcaatgtcctatacgtggacagg
cgccctgatcacgccatgcgctgcggaggaaagtaagctgcccatcaacccgttgagcaactctttgctgcgtcaccaca
acatggtctacgccacaacatcccgcagcgcaagcctccggcagaagaaggtcacctttgacagattgcaagtcctggat
gaccattaccgggacgtgctcaaggagatgaaggcgaaggcgtccacagttaaggctaagcttctatctatagaggaggc
ctgcaagctgacgcccccacattcggccaaatccaaatttggctatggggcaaaggacgtccggaacctatccagcaggg
ccgttaaccacatccgctccgtgtgggaggacttgctggaagacactgaaacaccaattgacaccaccatcatggcaaaa
agtgaggttttctgcgtccaaccagagaagggaggccgcaagccagctcgccttatcgtattcccagacctgggagttcg
tgtatgcgagaagatggccctttacgacgtggtctccacccttcctcaggccgtgatgggctcctcatacgggttccaat
actcccccaagcagcgggtcgagttcctggtgaatacctggaaatcaaagaaatgccctatgggcttctcatatgacacc
cgctgttttgactcaacggtcactgagagtgacattcgtgttgaggagtcaatttaccaatgttgtgacttggcccccga
ggccagacaggccataaggtcgctcacagagcggctttacatcgggggtcccctgactaactcaaaagggcaaaactgcg
gttatcgccggtgccgcgcaagtggcgtgctgacgactagctgcggtaataccctcacatgttacttgaaggccactgcg
gcctgtcgagctgcaaagctccaggactgcacgatgctcgtgaacggagacgaccttgtcgttatctgtgaaagcgcggg
aacccaggaggatgcggcggccctacgagccttcacggaggctatgactaggtattccgccccccccggggatccgcccc
aaccagaatacgacctggagctgataacatcacgttcctccaatgtgtcagtcgcacacgatgcatctggcaaaagggta
tactacctcacccgtgaccccaccaccccccttgcacgggctgcgtgggagacagctagacacactccagtcaactcttg
gctaggcaatatcatcatgtatgcgcccaccctatgggcaaggatgattctgatgactcactttttctccatccttctag
ctcaagagcaacttgaaaaagccctggattgtcagatctacggggcttgctactccattgagccacttgacctacctcag
atcattgaacgactccatggtcttagcgcatttacactccacagttactctccaggtgagatcaatagggtggcttcatg
cctcaggaaacttggggtaccacccttgcgaacctggagacatcgggccagaagtgtccgcgctaagctactgtcccagg
gggggagggccgccacttgtggcagatacctctttaactgggcagtaaggaccaagcttaaactcactccaatcccggcc
gcgtcccagctggacttgtctggctggttcgtcgctggttacagcgggggagacatatatcacagcctgtctcgtgcccg
accccgctggtttccgttgtgcctactcctactttctgtaggggtaggcatttacctgctccccaaccgatga


© 1998-2020 Legal notice