euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence AF054250_NS5B_C1b


Tools

>gnl|euhcvdb|AF054250_NS5B_C1b NS5B protein coding sequence (ns5b sequence)
tcaatgtcctatacgtggacaggcgcyctgatcacgccatgcgctgcggaggaaagtaagctgcccatcaacccgttgag
caactctttgctgcgtcaccacaacatggtctacgccacaacatcccgcagcgcaagcctccggcagaagaaggtcacct
ttgacagattgcaagtcctggaygaccattaccgggacgtgctcaaggagatgaaggcgaaggcgtccacagttaaggct
aagcttctatctatagaggaggcctgcaagctgacgcccccacattcggccaaatccaaatttggctatggggcaaagga
cgtccggaacctatccagcagggccgttaaccacatccgctccgtgtgggaggacttgctggaagacactgaaacaccaa
ttgacaccaccatcatggcaaaaagtgaggttttctgcgtccaaccagagaarggaggccgcaagccagctcgccttatc
gtattcccagacctgggagttcgtgtatgcgagaagatggccctttacgacgtggtctccacccttcctcaggccgtgat
gggctcctcatacggrtttcaatactcccccaagcagcgggtcgagttcctggtgaatacctggaaatcaaagaaatgcc
ctatgggcttctcatatgacacccgctgttttgactcaacggtcactgagagtgacattcgtgttgaggagtcaatttac
caatgttgtgacttggcccccgaggccagacaggccataaggtcgctcacagagcggctttacatcgggggtcccctgac
taactcaaaagggcagaactgcggttatcgccggtgccgcgcaagtggcgtgctgacgactagctgcggtaataccctca
catgttacttgaargccactgcggcctgtcgagctgcaaagctccaggactgcacgatgctcgtgaacggagacgacctt
gtcgttatctgtgaaagcgcgggaacccaggaggatgcggcggccctacgagccttcacggaggctatgactaggtaytc
cgccccccccggggatccgccccaaccagaatacgacctggagctgataacatcatgttcctccaatgtgtcagtcgcrc
acgatgcatctggcaaaagggtatactacctcacccgtgaccccaccaccccccttgcacgggctgcgtgggagacagct
agacacactccaatcaactcttggctaggcaatatcatcatgtatgcgcccaccctatgggcaaggatgattctgatgac
tcactttttctccatccttctagctcaagagcaacttgaaaaagccctggattgtcagatctacggggcttgctactcca
ttgagccacttgacctacctcagatcattgaacgactccatggtcttagcgcatttacactccacagttactctccaggt
gagatcaatagggtggcttcatgcctcaggaaacttggggtaccacccttgcgaacctggagacatcgggccagaagtgt
ccgcgctaagctactgtcccagggggggagggccgccacttgtggcagatacctctttaactgggcagtaaggaccaagc
ttaaactcactccaatcccggctgcgtcccagctggacttgtccggctggttcgtcgctggttacagcgggggagacata
tatcacagcctgtctcgtgcccgaccccgctggtttccgttgtgcctactcctactttctgtaggggtaggcatttacct
gctccccaaccga


© 1998-2020 Legal notice