euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence AF054250_321_344_C1b


Tools

>gnl|euhcvdb|AF054250_321_344_C1b 5UTR domain IV is a component of the IRES
gaccgtgcaccatgagcacgaatc


© 1998-2020 Legal notice