euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence D88474_866_1289_P6e


Tools

>gnl|euhcvdb|D88474_866_1289_P6e Feature misc_feature - Hepatitis C virus partial genome, complete 5'UTR, partial CDS (Contains: C, E1, E2), no 3'UTR.
cttccttttggcactgctctcgtgcctcaccacgcctgcctcagccgtgcactataccaacaagtctggtctttaccacc
tgaccaatgactgccctaacagcagcatcgtgtatgaggcgccaaccattataatgcactttcctggctgcgtcccctgt
gtcaaggtcaacaaccggtccacatgctggctgtcagcttcgcccacgctggctgtcccgaacgcgtcaacacctctcac
tgggttccgcaaacatgtggaccttatggtgggcgcagctgctttctgttcagctatgtacatgggtgacatatgtggtg
gtctgttcctactcggacaggtcgtcacgattagacctcgcctacaccagaccgtccaggagtgcaattgttccatctac
acaggcaagattactgggcatcgc


© 1998-2020 Legal notice