euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence D88474_41_351_P6e


Tools

>gnl|euhcvdb|D88474_41_351_P6e The internal ribosome entry site (IRES) is made up by domains II to IV of the 5UTR
cctgtgaggaactactgtcttcacgcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccaggacccc
ccctcccgggagagccatagtggtctgcggaaccggtgagtacaccggaattgccaggacgaccgggtcctttcttggat
caacccgctcaatgcctggagatttgggcgtgcccccgcgagactgctagccgagtagtgttgggtcgcgaaaggccttg
tggtactgcctgatagggtgcttgcgagtgccccgggaggtctcgtagaccgtgcatcatgagcacacttc


© 1998-2020 Legal notice