euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence D88474_41_115_P6e


Tools

>gnl|euhcvdb|D88474_41_115_P6e 5UTR domain II is a component of the IRES
cctgtgaggaactactgtcttcacgcagaaagcgtctagccatggcgttagtatgagtgtcgtgcagcctccagg


© 1998-2020 Legal notice