euHCVdb logo

The Nobel Prize in Physiology or Medicine 2020 "for the discovery of Hepatitis C virus".


View Sequence D88474_1_338_P6e


Tools

>gnl|euhcvdb|D88474_1_338_P6e 5UTR highly conserved genomic region (contains four structural domains (I to IV), domains II to IV make up the internal ribosome entry site (IRES))
gccagcccctaacggggcgacactccaccatgatcactcccctgtgaggaactactgtcttcacgcagaaagcgtctagc
catggcgttagtatgagtgtcgtgcagcctccaggaccccccctcccgggagagccatagtggtctgcggaaccggtgag
tacaccggaattgccaggacgaccgggtcctttcttggatcaacccgctcaatgcctggagatttgggcgtgcccccgcg
agactgctagccgagtagtgttgggtcgcgaaaggccttgtggtactgcctgatagggtgcttgcgagtgccccgggagg
tctcgtagaccgtgcatc


© 1998-2020 Legal notice